Gene/insert name: Yellow fluorescent protein
Insert size: 720
Vector backbone: pcDNA3
Backbone manufacturer: Invitrogen
Backbone size w/o insert (bp): 5446
Selectable markers: Neomycin
Growth strain(s): DH5alpha
Growth temperature (℃): 37
High or low copy: High Copy
5' sequencing primer: T7
3' sequencing primer: GTCTTGTAGTTGCCGTCGTC

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'.